EST details — SGN-E158898

Search information 
Request: 158898Match: SGN-E158898
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64565Clone name: cLEM-6-I13
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C180884 is on microarray TOM1: SGN-S1-1-7.1.17.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64565 [cLEM-6-I13] Trace: SGN-T84558 EST: SGN-E270802 Direction: 5' Facility: TIGR
Clone: SGN-C180884 [TUS-35-I10] Trace: SGN-T193636 EST: SGN-E392310 Direction: 5' Facility: INRA
Clone: SGN-C180884 [TUS-35-I10] Trace: SGN-T193877 EST: SGN-E392551 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E158898Length: 526 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E158898 [] (called/trimmed by facility)
TTTGTAAGCGGAGATTAATGGCAGAAACGATGGAAGTGGAAGTGGAAGCTGCGGCGGCGGCAGAGAGAGAAGCAACCAACAGTGTCATATGTCAG
TTGGCTGACCCAGAAGGGAATCCGTTGGGTGCTGCCTTGTACCTCCCTGAAAACGCTAGTCCAAAAGAGCTTAATCAAGTTGTCAATAAGCTTCT
CAGCAATGAGGAAAAGTTGCCTTATGCATTTTATATCTCAGATGAAGAGCTTGTGGTGCAGCTTGGATCATACTTAGAGAAGAATAAAGTGTCTG
TGGAAAAAGTCTTGACCATAGTTTATCAACCACAAGCAGTGTTTCGAATCCGCCCTGTCACTCGTTGTTCGGCCACAATTGCTGGTCATACTGAA
GCTGTTCTTTCAGTTGCCTTCAGTCCTGATGGACGACAGTTGGCAAGTGGATCTGGTGACACTACAGTTCGTTTGTGGGATCTAAATACCCAGAC
ACCGTTGTTTACATGTCAAGGGCACAGAAATTGGGTTCTTTCTGTTGCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T84558 [Download] [View] Facility Assigned ID: TGFAU55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence