EST details — SGN-E15931

Search information 
Request: 15931Match: SGN-E15931
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C147704Clone name: cTOF-5-L14
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181731 is on microarray TOM1: SGN-S1-1-8.4.12.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C147704 [cTOF-5-L14] Trace: SGN-T154051 EST: SGN-E341028 Direction: 5' Facility: TIGR
Clone: SGN-C181731 [TUS-37-L17] Trace: SGN-T194060 EST: SGN-E392734 Direction: 5' Facility: INRA
Clone: SGN-C181731 [TUS-37-L17] Trace: SGN-T199292 EST: SGN-E397966 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E15931Length: 190 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E15931 [] (called/trimmed by facility)
GTTGAATTTGCACCAGAGTCACCAGCTGATATGGGTCAGGGCGAACCATATGGTTTACGATTATTGCACGGATAGCGCTAGGTTCCCTGTTGCCC
CTGTTGAGTGCCAGCACCACCAGCACAAGACGAATCATAACTAGGTGTGGAGGAAAATTGGAGTTCAGTCTTGCATTGTATAAAAAGATTTAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T154051 [Download] [View] Facility Assigned ID: TOFAT67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence