EST details — SGN-E160795

Search information 
Request: 160795Match: SGN-E160795
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37344Clone name: cLEG-41-M19
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177388 is on microarray TOM1: SGN-S1-1-7.3.6.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37344 [cLEG-41-M19] Trace: SGN-T71894 EST: SGN-E258862 Direction: 5' Facility: TIGR
Clone: SGN-C177388 [TUS-26-G18] Trace: SGN-T182423 EST: SGN-E368290 Direction: 3' Facility: INRA
Clone: SGN-C177388 [TUS-26-G18] Trace: SGN-T182424 EST: SGN-E368291 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E160795Length: 466 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E160795 [] (called/trimmed by facility)
TGGCAATTAGAACCATTTCAAGACTAAAAATTCCATCTTTGCTTCTTAAACACCTTTCAGTTTCTCCATTACCATCAATTTCTTCCACCTTAACA
TCTTCTTCTTCATGTTCTCCATCATGGGTTCCTGAGTTTTCTAGAAGTTCAGTGAGGGATGTGAGGTGGTACCATGATGGAAGACCAAGAGGGTC
ACTTTGGAGGGGAAAGAAATTGATTGGAAAAGAAGCACTTTTTGTGATTCTTGGGTTAAGAAGATTCAAAGATGATGAAGAAAAGCTTGACAAGT
TTGTTAAAACACATGTCCTTAGACTTCTTAAAATGGATATGATTGCTGTACTTAATGAACTTGAACGCCAAGAAGAAGTCTCTCTTGCTGTTAAG
GTGTTTTGGGTAATTCAGAAACAAGCCTGGTACCAACCCGATGTCTATCTTTACAAGGACCTGATCATTGCGTTGGCGAGACGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T71894 [Download] [View] Facility Assigned ID: TBFGE82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence