Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E160884

Search information 
Request: 160884Match: SGN-E160884
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37099Clone name: cLEG-41-A20
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177293 is on microarray TOM1: SGN-S1-1-6.3.6.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37099 [cLEG-41-A20] Trace: SGN-T71902 EST: SGN-E258870 Direction: 5' Facility: TIGR
Clone: SGN-C177293 [TUS-26-C19] Trace: SGN-T182194 EST: SGN-E368784 Direction: 3' Facility: INRA
Clone: SGN-C177293 [TUS-26-C19] Trace: SGN-T182195 EST: SGN-E368785 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E160884Length: 423 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E160884 [] (called/trimmed by facility)
AGTAATCATGAAGAAACAAACAATATGACCATTTCTTCTCTTCTTCTTCCTCCTCCTCCTCCTTTCATCAATTACAATAATAATAATAATAATAT
TTATGGAAAGTCTATTTCCATTCATCAACCTCATCGATTTTCGTTCCGAGTTATCAATGATTCGAATAGAACAGAGTTAGCTACTGAAGATGCTG
ATAAACTTGTAGATGGAATGGATTTTGGGGAATTGTGTGATGAGTTTGAATGCATTAGTAGCCCTTCTGTGGAAGCTACTGCTAGGCAGCTAGTT
CGAGATATTCTCGAACTACGTGAAGGCAATCGTGCCCTCGGTACCTTTGCTGTCTCTGTCAAGTATAAGGATCCAGTGAGAAGTTTTACAGGACG
AGACAAGTACAAGAGACCATTATGGATAACTGATGCTCTGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T71902 [Download] [View] Facility Assigned ID: TBFGF10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence