EST details — SGN-E162385

Search information 
Request: 162385Match: SGN-E162385
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64114Clone name: cLEM-5-C24
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177843 is on microarray TOM1: SGN-S1-1-8.2.6.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64114 [cLEM-5-C24] Trace: SGN-T85021 EST: SGN-E271216 Direction: 5' Facility: TIGR
Clone: SGN-C177843 [TUS-27-J17] Trace: SGN-T1471 EST: SGN-E378277 Direction: 5' Facility: Giov. Lab
Clone: SGN-C177843 [TUS-27-J17] Trace: SGN-T183091 EST: SGN-E370854 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E162385Length: 538 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E162385 [] (called/trimmed by facility)
CTGGATCATTTAGTTCAGAGGACCGATATTGACACATCAAGAATAGTAGTCTTTGGAAGGTCACTTGGAGGAGCTGTTGGCACTGTTCTTACCAA
AAACAATCCTGACAAGGTAGCTGGGCTCATTTTGGAGAATACTTTCACCTCTATCCTGGATATGGCAGGAGTTCTCTTGCCATTCTTGAAGTGGG
TCATTGGTGGCAGTGGCTCAAAGGGTTTCAAGCTTCTTAACTTTGTTGTTCGATCTCCATGGAATACCATTGATGTCATTGGTGAGATCAGGCAA
CCAATCCTCTTCCTATCTGGATTACAAGATGAGATGGTTCCACCATTCCACATGCAGATGCTGTATGCAAAGGCAGCGGCACGTAACAGGCAATG
CTTATTTGTGGAATTTCCTAGTGGGATGCACATGGATACCTGGTTGGCAGGTGGTGATCATTATTGGAGGACAATTCAGAAATATTTGGAAGAAA
CTGTCCCAGAGAAGAAGGATGATGAATCAAAGAAGGATTCCGAACTGTCCTCTAAGCAAAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T85021 [Download] [View] Facility Assigned ID: TGFAR24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence