EST details — SGN-E163080

Search information 
Request: 163080Match: SGN-E163080
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64207Clone name: cLEM-5-H14
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177893 is on microarray TOM1: SGN-S1-1-6.4.6.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64207 [cLEM-5-H14] Trace: SGN-T85121 EST: SGN-E271316 Direction: 5' Facility: TIGR
Clone: SGN-C177893 [TUS-27-L19] Trace: SGN-T183177 EST: SGN-E370940 Direction: 3' Facility: INRA
Clone: SGN-C177893 [TUS-27-L19] Trace: SGN-T183178 EST: SGN-E370941 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E163080Length: 518 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E163080 [] (called/trimmed by facility)
ATGACTATCCTCAACTGCAGTTTGAGGCAGCGTGGGCTCTTACAAATATTGCATCTGGTACATCAGAAAACACTAAAGTTGTGATTGATTATGGT
TCTGTCCCAATTTTCATCAGACTTCTAAGTTCACCAAGTGATGATGTCCGTGAACAGGCCGTTTGGGCTTTGGGAAATATTGCTGGTGACTCGCC
CAAGTATCGTGACCTTGTGCTTGGCCATGGAGCTTTAGTGGCATTGCTGGCACAATTTAATGAGCAGGCAAAGCTATCTATGTTGAGAAATGCTA
CCTGGACATTGTCAAACTTTTGTAGGGGAAAACCTCAGCCACTGTTCGAGCAGACAAAAGCGGCACTCCCCACTCTTGGTCGCCTTATCCACTCA
AATGATGAAGAAGTCTTGACAGATGCATGCTGGGCTCTTTCATATCTTTCTGATGGAACTAATGACAAAATCCAGGCTGTTATTGAAGCTGGAGT
GTGTTCCCGCCTTGTTGAGCTGCTACTTCATTCTTCACCATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T85121 [Download] [View] Facility Assigned ID: TGFAT43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence