EST details — SGN-E163479

Search information 
Request: 163479Match: SGN-E163479
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78967Clone name: cLES-7-F8
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184278 is on microarray TOM1: SGN-S1-1-5.2.16.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78967 [cLES-7-F8] Trace: SGN-T98801 EST: SGN-E288045 Direction: 5' Facility: TIGR
Clone: SGN-C184278 [TUS-44-F20] Trace: SGN-T198384 EST: SGN-E397058 Direction: 3' Facility: INRA
Clone: SGN-C184278 [TUS-44-F20] Trace: SGN-T198385 EST: SGN-E397059 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E163479Length: 620 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E163479 [] (called/trimmed by facility)
AACTGAAAATGCACCACTCAGGGGGGCAATGTGGCGGAGAAAGAGGTCGAGAATAATATGATTTATCGATCTTTAACAAAATTGTACTTCGTAAT
AACTATGTCTCAACTCCCAATTCAATACTTGATAGGAGCAATAACGGCGAGTTGAGGTCCAAGCTTCTCCTCAGCAGCTTTCTCAGCCTTAACTC
TAAGTTTTGCCAACTGCTTTCTCCTCTCGTATGCTACCTGAGCTCTCTCCTTTCTCTTGTTCTCGAGTTCCTTGATAGTATCATAATGGTTCCAT
CCAACTTCTGATGAAAGCTTGCCCAAGAGACAGTACTTGTGTCCGGATTGGAGCCTCAATACCTTTAGAGCATCGGGGATAACCATCCTCTTAAT
CTTGTCATATGGTGGTGGAACACCCTCATAAACCTTCAAGCGGGCAAGTGCAGCTGCTCCACGCTTGGTCTTGTGAGGAATCATCCCACGGATTG
TACGCCAAAGGATCTTAGAAGGAGCACGAAAATGGATAGGACCATGAGATGGCTTTGTATTCATTCTCTTACGAAGAAATCTAAGATACTTCATT
TTCTGGCGAACAAGTCCACCGGAAAGACAAATCTCTTTACATTTAACAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T98801 [Download] [View] Facility Assigned ID: TPSBB28THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence