EST details — SGN-E163917

Search information 
Request: 163917Match: SGN-E163917
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64556Clone name: cLEM-6-H23
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C180882 is on microarray TOM1: SGN-S1-1-1.1.17.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64556 [cLEM-6-H23] Trace: SGN-T84647 EST: SGN-E270891 Direction: 5' Facility: TIGR
Clone: SGN-C180882 [TUS-35-I8] Trace: SGN-T193635 EST: SGN-E392309 Direction: 5' Facility: INRA
Clone: SGN-C180882 [TUS-35-I8] Trace: SGN-T193876 EST: SGN-E392550 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E163917Length: 470 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E163917 [] (called/trimmed by facility)
CAACAATATCATCTCTTGTAATTGCCCCTCTCTCAAATGCACCCACAAGCTCCCCTGCTTCTACCATAGCAGCTTCATTATCAACAAACACTTTT
CCCCTCTTCAACGCTTCATCGTCGCATTCTCTCATCGAATGCTTAAACGATCCAACCAAATCCAAATGCGCTCCTTCTTTAAGCTTCTTCCCTTT
CACCAATGGTGTCCCTGAATTCGTAGCACAGCTCACAATATCTCCCAACCCCACAACTTCCTCAAGAGATGCATTACTCTCAAAACTCACCCCTT
CAAAACTAGCTTCACTTTGCAAATTCTCGATCACCCGCTTCGCCTTATCAGCAGTTCGATTCCACACTATGACTTTCTTCAAATTTGGCCTAACT
GTCAGATGTGCCTTGATCAAATGCGGCGCTAAAGTACCTGCACCGATCATCAAAAGGGTCTCTGAATCTTGTCTTGATAAGAATTTTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T84647 [Download] [View] Facility Assigned ID: TGFAW48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence