EST details — SGN-E164078

Search information 
Request: 164078Match: SGN-E164078
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84916Clone name: cLET-2-L10
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184537 is on microarray TOM1: SGN-S1-1-2.1.14.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C84916 [cLET-2-L10] Trace: SGN-T102800 EST: SGN-E291259 Direction: 5' Facility: TIGR
Clone: SGN-C184537 [TUS-45-A15] Trace: SGN-T1829 EST: SGN-E378227 Direction: 5' Facility: Giov. Lab
Clone: SGN-C184537 [TUS-45-A15] Trace: SGN-T198453 EST: SGN-E397127 Direction: 5' Facility: INRA
Clone: SGN-C184537 [TUS-45-A15] Trace: SGN-T198544 EST: SGN-E397218 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E164078Length: 431 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E164078 [] (called/trimmed by facility)
GAGTATTCATGAAAATTCCAGTATTGTGACTTCGCACGCAACATCTACTCAGCCAGCCTCCAGTCGCCATTGTTATGCCCGGTATGGAAGCTGAG
AACTCAAACGCCTCCCGAGCTGAAGAACTCAAGCAACTCGCAAATGAAGCATTCAAAGGGCATAAGTATTCGCAAGCTATTGATCTGTACACACA
AGCGATTGAGTTGAACGGTGAGAATGCGGTGTACTATGCTAACCGTGCGTTTGCTCACTCCAAATTGGAGGAATATGGAAGCGCAATACAGGATG
GAACTAGAGCTATTGAAATTGACCCTAGATATTCAAAGGGTTATTATAGGAGAGGAGCTGCATATTTGGCAATGGGGAAGTTCAAAGATGCACTC
AAGGATTTTCAACAGGTCAAGAAATTATGTCCAAACGACCCAGATGCTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T102800 [Download] [View] Facility Assigned ID: TMEAH65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence