EST details — SGN-E165119

Search information 
Request: 165119Match: SGN-E165119
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C79289Clone name: cLES-8-H11
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C79289 [cLES-8-H11] Trace: SGN-T99023 EST: SGN-E288503 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E165119Length: 430 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E165119 [] (called/trimmed by facility)
TTTGTTCATGATCGAGGCAAATCACTATTCGCTGTGAAGGAAGATGGGGAAGCAACCGGTGAAGCTGAAGGCTGTTGTATACGCTATATCTCCAT
TTCAACAGAAAATTATGCCTGGTTTATGGAAGGATCTTCCTGGTAAGATCCATCACAAAGTGTCTGAAAATTGGATCAGCGCTACCCTGTTGCTT
GGTCCACTCGTCGGAACCTACTCGTATGTGCAGAACTTCCTGGAAAAGGAGAAGTTAGAACACAGATACTAAAACTGTTTCTTCATCAGTCTGTT
GGATACATCTCTATTCCATTTTGCAGTTTTCAACAGGAAATAAGCTGCCATTGTTGCATTTTTTTTTTTGGAACTTGGTATTTTGAAGATAATTA
ACTTGTATGGCGCCCTATAAATAACAACTAAATTCTCTGTTGGGGGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T99023 [Download] [View] Facility Assigned ID: TPSBE42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence