EST details — SGN-E165596

Search information 
Request: 165596Match: SGN-E165596
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C85676Clone name: cLET-3-N16
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C85676 [cLET-3-N16] Trace: SGN-T103241 EST: SGN-E289570 Direction: 5' Facility: TIGR
Clone: SGN-C190650 [TUS-60-P8] Trace: SGN-T341474 EST: SGN-E540599 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C190650 [TUS-60-P8] Trace: SGN-T349286 EST: SGN-E548411 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E165596Length: 517 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E165596 [] (called/trimmed by facility)
CAAGTATCATTTGTGCTTAGACTTGGTCAAACAGGTCCCTTTGTTTCAACATATGGACAGTTTGGTTCTAGAGAACATATGTGATCGTGTCAAGT
CATTGATTTTCACTAAGGGGGAAACAGTATCTAGGTGTTTTTGCATGCAACAACATCAAAGAAACAATCAATGCAACTAAATATGAGAAACATAG
AATGGTGGATGAGAAGAAGAAGGTTCCCTAGAGAGTTAAAGCAAAGAACTAGAAATTTTCAAAGGCAAAAATGGGCTGCAATGCGTGGTGTTGAT
GAATGTGACATGATTAGAAATATTCCTGAGGGTCTAAGGAGGGACATCAAGTATCATTTGTGCTTAGACTTGGTCAAACAGGTCCCTTTGTTTCA
ACATATGGACAGTTTGGTTCTAGAGAACATATGTGATCGTGTCAAGTCATTGATTTTCACTAAGGGGGAAACAGTATCTAGAGAGGGTGATCCAG
TACAAAGAATGTTATTTATTGTAAGAGGACACCTTCAAAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T103241 [Download] [View] Facility Assigned ID: TMEAL80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence