EST details — SGN-E166365

Search information 
Request: 166365Match: SGN-E166365
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65087Clone name: cLEM-8-E3
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178267 is on microarray TOM1: SGN-S1-1-8.4.4.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65087 [cLEM-8-E3] Trace: SGN-T85312 EST: SGN-E271761 Direction: 5' Facility: TIGR
Clone: SGN-C178267 [TUS-28-L9] Trace: SGN-T183507 EST: SGN-E371147 Direction: 3' Facility: INRA
Clone: SGN-C178267 [TUS-28-L9] Trace: SGN-T183508 EST: SGN-E371148 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E166365Length: 656 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E166365 [] (called/trimmed by facility)
AAGGTGTTCGCTGTCAGAAACTAAATACAGATTGTTCATTGGTAGTGTACCAAAGAGCTGGGGTGATGATGACTTCAGAAAAGTCATTGATGGGA
CTGGTCCTGGTGCAGAATTAATAGAACTCATAAAGGATCCTCAAAACCCAGCACGTAATAGGGGTTTTGCTTTTGTTGAATATTACAATAATGCC
TGTGCGGATTACTCTCGGAGAAAAATGGTAAGTACAAACTTTAAGCTGGAGGGAAATTCACCAACTGTCACCTGGGCTGATCCGAAGATTACACC
TGATCATTCTTCTGCCGCTGCTCAGGTCAAAGCACTCTATGTGAAGAACATTCCAGAAAACACTCCTACTGAACAATTGAAGGAATTGTTCCAAC
GCCATGGTGAAGTTACCAGAGTTGTTATGCCACCAGCCAAGGTTGGTGGTAAACGAGACTTTGGATTTGTCCATTATGCAGAAAGGTCAAGCGCT
CTGAAAGCTGTCAAAGACACTGAAACATATGAAGTAAATGGTCAGATGTTAGAAGTAGTTCTTGCAAAGCCTCAGACTGAAAAGAAGTTTGATGC
AGCTAGTCCTCACAATGCGATGCCACATCATAATTATATTCCCCATCCAGGCTATGGTGCATTTCCGATGAACCCGTATGCACCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T85312 [Download] [View] Facility Assigned ID: TGFBC26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence