EST details — SGN-E16662

Search information 
Request: 16662Match: SGN-E16662
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24432Clone name: cLED-8-D6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181120 is on microarray TOM1: SGN-S1-1-3.3.15.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24432 [cLED-8-D6] Trace: SGN-T50831 EST: SGN-E232898 Direction: 5' Facility: TIGR
Clone: SGN-C181120 [TUS-36-C6] Trace: SGN-T193540 EST: SGN-E392214 Direction: 3' Facility: INRA
Clone: SGN-C181120 [TUS-36-C6] Trace: SGN-T193541 EST: SGN-E392215 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E16662Length: 503 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E16662 [] (called/trimmed by facility)
GCACCAGCTATACCACCCACCCATGCACCCACCCACCTATCTAAACCATATTTTTTCCCTTTAATCTAATGGAGCTTCTCTTAGTATTCTCCCAA
TGTCCACCATTCCCTCCGCCGCCTACGGCGGTCCACCACCACCTCTAACCACCACCAATACGCTCATCGAGAGCCTCAACAAAATAGGCCTCGGC
TACGCAATTGCAATTGCCCTTGCCTTCCTCTTCCTCCTATCAACTCTCATCCTTTCATCTTACCTATGCTGCCGCTCCGCTGCCTATCGCCGCCG
TCAAGCCCAATCCCAGTCTCGAAACCCGAACACCGGAATTTACATTCCGAGTGTAATTTTCGTTGCTGAGGAAGACGAAAACGACGACGTTTCAT
CTCAGAACACTTTCGCGGGCCTCAATCAAGCAGTAATCAACTCTTACCCTAAATTAATTTACTCAAGCAGAAACGGAAATTGGGGAAACGGAAAC
GGAAGCAGAAACGACGTCGTGTGTGCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T50831 [Download] [View] Facility Assigned ID: TOVBF15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence