EST details — SGN-E166894

Search information 
Request: 166894Match: SGN-E166894
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65045Clone name: cLEM-8-C4
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178238 is on microarray TOM1: SGN-S1-1-5.3.4.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65045 [cLEM-8-C4] Trace: SGN-T85513 EST: SGN-E271962 Direction: 5' Facility: TIGR
Clone: SGN-C178238 [TUS-28-K4] Trace: SGN-T183372 EST: SGN-E370182 Direction: 3' Facility: INRA
Clone: SGN-C178238 [TUS-28-K4] Trace: SGN-T183373 EST: SGN-E370183 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E166894Length: 502 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E166894 [] (called/trimmed by facility)
CACAAACCTTACAAAAGCATCTTCTTTACGTTACACATTTGCCTTTCTGCCTCCCATCATTTTTTTTCCTCTCCAAATTATCAAAATTATTGCCC
CAGTTTCTCTCTGGTTTGGAACTGCATTTATCTATGGTTTAATTGAATTAATAAATTTTTTTTCTCTACTCTGTACCCGTCAATTTAAGTACAGT
TTCAGTTTTCGCAACAATTTTTTGGGATTTTGGCTCTGGCTTAGAGACATAACAAAAAGCGGTTATGGATCGAGAAGGAGGATCAGCCGGATCTT
GTTATTATTCAGTTCTAGGGGTACGCAACGACGCCTCCTGCTCCGACATTCGCTCAGCTTATCGGAAACTAGCTCTGAAATGGCACCCGGATAGG
TGGGCGAAGAATCCAGCGCTGGCCGGTGAAGCGAAACTCCGATTTCAGAAAATCCAAGAGGCTTATTCAGTTCTCTCCGATCAAGACAAGAGGTC
AATGTACGACGCCGGTTTCCTCGATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T85513 [Download] [View] Facility Assigned ID: TGFBD14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence