EST details — SGN-E16708

Search information 
Request: 16708Match: SGN-E16708
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53871Clone name: cLEL-1-K17
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53871 [cLEL-1-K17] Trace: SGN-T2662 EST: SGN-E217146 Direction: 3' Facility: Cereon
Clone: SGN-C53871 [cLEL-1-K17] Trace: SGN-T20616 EST: SGN-E281432 Direction: 3' Facility: Novartis
Clone: SGN-C53871 [cLEL-1-K17] Trace: SGN-T20617 EST: SGN-E281238 Direction: 5' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E16708Length: 592 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E16708 [] (called/trimmed by facility)
GATAGTTAGTTTAGTACGTACCACTTCCCCCACCTTGGTGGAAAATCGATGGGGCCGGGGGCCGTTCTAGAAGTACTCTCGAGTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTGCTGGGATCTATTGTTTTAATTCAGTAAACCTTCTCAAGGCTGACAACATGAAATAGTTGTTCAAAATTGTAAACAAC
TGAATGTCTCGAGATAAAAGGCTAAAAACCAGATAATGCAAAAATATTAAGCAAAACGATAATGTCTCAAAAAGGTCAAGCAGATCAACGGTAAC
GGCGGAGAGATAGAGTCTGGTTCCTTTTCCAGGTTGCCCTTCTTGACGGGCGAGCTTTGTGGTGGAGATGTCCTTTTCCGCGGAGTCCTCTGTAT
TTCTTACCAGCTGAAGTGAGACCACGTAGTTCTCTGTGCTTATGCACTGGGTTGCAGATCCAGTTGATCCTTGGNATCGTTGCGAATACCAGCAT
GGGCTTGGTCAACCAATATTACCTNAAAGTACTTGTAGGTAGAATCCTCATTAATCCAGTAAGAATTGAGGACTCTAAGACCACCCAATTTCCTT
CCAGCACGCTCCTAACAACAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T20617 [Download] [View] Facility Assigned ID: tomato010169.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence