EST details — SGN-E169598

Search information 
Request: 169598Match: SGN-E169598
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C49333Clone name: cLEI-7-O19
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C49333 [cLEI-7-O19] Trace: SGN-T80981 EST: SGN-E266756 Direction: 5' Facility: TIGR
Clone: SGN-C188958 [TUS-56-I20] Trace: SGN-T338648 EST: SGN-E537773 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188958 [TUS-56-I20] Trace: SGN-T338650 EST: SGN-E537775 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E169598Length: 406 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E169598 [] (called/trimmed by facility)
TACCGTCGGTGTTCAGTTGAATTCATCTCTTCCTTTCAACATTACCAGCAGCAACACGATCGTTTTCCTGAACTGTTCTCAGAGTTTGCTGTCGT
CTCCGCTTAATTGCACTGCTGAGAGTTTGTGTCATACTTACCTGAACGGAACTTCTGAAAATGATGGAGCTATTGGCGCGTGTAGGAACGCGCCG
ATTTGTTGTACGTTTAGGGCAGGTGGATCGTCCACGTCGTATATGATTCGGGTTAGGGAATCGGGTTGTCGGGCTTACCGGAGTTTTGTTAATTT
GAATCCATCGCTACCGGCTAGTAGATGGCCGGAAGCCGGGATGGAATTGCAGTGGGTTTCACCACCGGAGCCGGATTGTACGATTCACTCCGATT
GTGATTCTGATTCGACTTGTGGACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T80981 [Download] [View] Facility Assigned ID: TGSAY94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence