Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E170219

Search information 
Request: 170219Match: SGN-E170219
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C163249Clone name: cTOS-20-C9
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C163249 [cTOS-20-C9] Trace: SGN-T167860 EST: SGN-E356124 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E170219Length: 288 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E170219 [] (called/trimmed by facility)
ATTTAGATAGGTTATATATCATCTAACATGTGGCTAATCGAAGTAGATTCCCATGTTGTCACTAGTAGCCTGTGTCAAGTTGTACTCTAGTGGGT
GTTTTTTTATAGGGCCAAAGGCTTATAGTTTGTTTTCTTTGTGCTACTCACCTCTAGTCCAGCGCATCGGCTTCTTGTTTCTAGCAGGCTGATTA
CTTTTCTCAAGCTTTTAAGAGAGAGAGAAGAATGAGACTCCTTGAGGGAGTGCTTACAGTGAATTTTTTTTTTTGTGTAAATCCTGAATGTGAAG
GGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T167860 [Download] [View] Facility Assigned ID: TSCCY17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence