EST details — SGN-E172660

Search information 
Request: 172660Match: SGN-E172660
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70007Clone name: cLER-13-E23
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70007 [cLER-13-E23] Trace: SGN-T94719 EST: SGN-E284025 Direction: 5' Facility: TIGR
Clone: SGN-C189889 [TUS-58-P15] Trace: SGN-T340164 EST: SGN-E539289 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189889 [TUS-58-P15] Trace: SGN-T340167 EST: SGN-E539292 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E172660Length: 572 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E172660 [] (called/trimmed by facility)
CAAAGTACCACACAAAGTGACATGCTTTACATTGCTACTAGCCAAGGAGGCAGTATTGACATTGGATAATGTGGCCAAGAGAGGAATCTCTCTAT
GCAATAGATGTTCCTTGTGGGGAATGCTAATGAGACAGTGAGACATCTCTTATTACATTGCAACTTGACTGGGCAACTGTGGCAGATTTTCCTTA
ATCTCAGAGGCATATCTTGATGTATGCCTAGCAAGATTGATGAGACTCTATTCGGTTGGGAGATGGCTGGAGTTGGGGCTACAAACAGAGAAAGA
TGGCGGATGATCCCTGCTAGTATTTGGTGGCTATATGGAGGGAGAGAAACGAGAGATGTTACCAAAATAGGAGCAAAAACCTGCAGGAAATTAAG
CTTAAGTGTGTTTTATTGATCTGCTTTTGGTGTACAAATGTCTACTCCAATGAAACTGAGTCAATCATAGATGTTTTAGGATCCATTTACATTTG
GTTCAGTTTTTTGGATTGAATATACTTACTTTCTGCTTTTTGTAATATGGCTTTTCAGTACTACCTAAGTACTATGTGAAATACAATGTTACAGG
TT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T94719 [Download] [View] Facility Assigned ID: TPRBW36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence