EST details — SGN-C172920

Search information 
Request: 172920Match: SGN-C172920
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C172920Clone name: TUS-14-M14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172920 is on microarray TOM1 spot ID 1-1-3.1.20.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14289 [cLEC-7-H11] Trace: SGN-T25455 EST: SGN-E202173 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378491Length: 858 bp (1126 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378491 [] (trimmed) TCCCCCGGGGTGCATGATACGGCAAAAGTATAGATCAAAAGGCTCTCTCTTCTATTCTTCTTTCATTTCCATCACCATGGATCCCTCTAAGTATC
GCCCATCAAGCGCATACGACACCCCTTTCTTGACAACAAATGCTGGTGGTCCTGTGTACAACAATGTTTCTTCCTTGACTGTTGGACCTAGAGGG
CCTGTTCTGCTTGAGGATTACTATCTAATTGAGAAGCTCGCGACATTTGATCGCGAGAAGATACCTGAACGTGTTGTTCATGCTAGAGGTGCTAG
TGCTAAGGGATTCTTTGAAGTTACTCATGACATTTCTCATCTTACTTGTGCTGATTTTCTCCGAGCTCCTGGCGCTCAAACGCCTGTTATTTGTC
GATTCTCTACTGTTGTCCATGAACGTGGAAGCCCCGAGTCTATCAGGGACATTCGTGGTTTTGCTGTCAAGTTCTACACCAGAGAGGGTAACTTT
GATCTTGTTGGAAACAATGTCCCCGTGTTCTTTAATCGTGATGCTAAGTCGTTCCCTGACACGATTCGTGCATTGAAACCAAATCCAAAGTCACA
CATTCAGGAGAACTGGAGGATACTTGATTTCTTCTCGTTCCTTCCTGAGAGTTTGCATACATTCGCCTTCTTCTACGATGATGTTTGTCTCCCAA
CGGATTACAGACACATGGAAGGTTTTGGCGTTCACGCGTATCAATTGATTAACAAAGAGGGGAAAGCACATTATGTGAAGTTCCACTGGAAGCCA
ACTTGTGGTGTGAAATGTATGTCTGAAGAAGAAGCTATTAGAGTCGGTGGTACTAATCATAGCCACGCGACCAAGGATCTTTACAATTCAATTGC
TGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378491] SGN-U578839 Tomato 200607 Build 2 480 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1264 [Download] [View] Facility Assigned ID: TUS14M14.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0038 Quality Trim Threshold: 20.5