EST details — SGN-C173523

Search information 
Request: 173523Match: SGN-C173523
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C173523Clone name: TUS-16-F17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173523 is on microarray TOM1 spot ID 1-1-8.2.18.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3314 [cLEC-20-D10] Trace: SGN-T27833 EST: SGN-E206051 Direction: 5' Facility: TIGR
Clone: SGN-C173523 [TUS-16-F17] Trace: SGN-T196792 EST: SGN-E395466 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395358Length: 522 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E395358 [] (trimmed) CTAAAACTACTGCATCGCCAATACAATGGGCACAAGGCAAGATAGTTGATGAACAAAGCTTCTTTAAGTGGTTCAGCGAAGTTGATAATATTGAT
GAAATCGGTGAGATAATCAAGGATGATCTGTGGTCCGATCCTCTCTTTAGTTTTCGATATGAGGCAGATGAAGAAAATGTTGATAATGTGGCAGT
GAAGAAATATGAAGATATGGTAGTGAAGGACAGTGAAGATGTAGAAGAAAATGATTAGAGGTTTGGTCCTTGTTATTCAAATGCCTTAGAAATGG
TTTTGAACTATTCACAAACTTGATTATAGCGACACTCTTCATGTGAGTTTACCTTACTATGTTGATAATTTTGTATTAATCTGTCTGAAGGTATA
TTTTGTCCATAGAAAGATCAGTACAACAGTTCATTCGGATGTGTGATCTCATTTCCTTAGCAGACTAACATATAGAACTGCTGAATTAGTTTGTG
GTGAGCTCGCTGATTAATCTGACAATGGACTACATTGTAGCACATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395358] SGN-U565244 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196684 [Download][View] Facility Assigned ID: FA0AAD4CC09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5