EST details — SGN-C173817

Search information 
Request: 173817Match: SGN-C173817
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C173817Clone name: TUS-17-B23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173817 is on microarray TOM1 spot ID 1-1-2.2.17.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5594 [cLEC-32-G19] Trace: SGN-T29931 EST: SGN-E207718 Direction: 5' Facility: TIGR
Clone: SGN-C173817 [TUS-17-B23] Trace: SGN-T189122 EST: SGN-E376508 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376509Length: 391 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E376509 [] (trimmed) GCCGTGATGATAATACTTTACTAATTACTTGTTCAAAAGAAGCTGATAATCATAACTGACATAAAGTCTAAGCTGATATAGCTACTGGCCTAAAC
AAAATGCCTAAATAGATCTGTGGTGTCCAATACTTCTCAGTACAAAAAAGTACAACAGAAGATTAACCAGATAATGCAATTCTCGACCTAAGGCA
AAACTCACGTGATACCAAGCCAGGCAGTATAATCACAAGCTGCAACACTAGCAAGGACTTATGCAAACGTCGCCAAAATGTTCTTCTTGAGGGTG
AACTCATCCGCCTTAGTGGGGCTGATTGACTTGGCAAGCATGCGCTCTAATCGCTGAATCTCATTGTTGGCGTAATCAGCTCCTTTTTTCATGGA
ACTCTTGGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376509] SGN-U577569 Tomato 200607 Build 2 93 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189123 [Download][View] Facility Assigned ID: FA0AAD5CA12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5