EST details — SGN-E174208

Search information 
Request: 174208Match: SGN-E174208
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C122662Clone name: cTOB-4-K2
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: Alias clone SGN-C182909 is on microarray TOM1: SGN-S1-1-6.1.5.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C122662 [cTOB-4-K2] Trace: SGN-T130520 EST: SGN-E315032 Direction: 5' Facility: TIGR
Clone: SGN-C182909 [TUS-40-M19] Trace: SGN-T191609 EST: SGN-E390283 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E174208Length: 566 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E174208 [] (called/trimmed by facility)
GCTTTTAAGTAGCATTTATCTACACAATAATAATATGGAGAAAATTGGAGGAATTAAAAGTTTTAACATGGAGAAAATTCCAAAGAAGCATTTTA
TCCTAGTTCATGGATTTTGTCATGGTTCTTGGTGTTGGTACAAAATTATCAATTTATTGGAAAAATGTGGTCATAAAGTGACTGCTTTAGACCTT
GGTGGTTGTGGAATTAATATGAAACAATTGAATGAAATTGATTCAATATTTGATTATATTCAACCTTTGATGGATCTTATGATATCTTTGTCTAA
AGATGAAAAGATTATTTTGGTTAGTCATAGTTACGGTGGTCTTTGTATTTCTCTTGCTATGGAAGCTTTCCCACACAAAATTTCAACAGGAGTGT
TTATCTCTGCTTATATGCCTAATCATGTGGATCCACCTTCTCTTCTTATTCTTGAGTACTTCAAGAGGACTTCAGTGGAGTCACTTATGGATTGC
CAATTTAAGTTTGATCAAGGCATGGAAAATCCACCAACAAGTGCTATTTTTGGCCCACAGTACATGCAAGCTAATCTTTACAAGAATTGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T130520 [Download] [View] Facility Assigned ID: TFBAN61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence