EST details — SGN-C174556

Search information 
Request: 174556Match: SGN-C174556
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C174556Clone name: TUS-19-A18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174556 is on microarray TOM1 spot ID 1-1-7.1.15.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23215 [cLED-4-M6] Trace: SGN-T49265 EST: SGN-E231496 Direction: 5' Facility: TIGR
Clone: SGN-C174556 [TUS-19-A18] Trace: SGN-T189298 EST: SGN-E376684 Direction: 3' Facility: INRA
Clone: SGN-C174556 [TUS-19-A18] Trace: SGN-T189299 EST: SGN-E376685 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378668Length: 812 bp (1134 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378668 [] (trimmed) CTTGTTTAGGATGTTGGTACTGGTAGTGGCCAGGTCGCTCAATCTTTAGCTAAGCTTTACAAGAATGTGATAGCTACAGACACAAGTCCAAAGCA
GCTTGAATTTGCAGCAAAGGTTCCAAATGTTCAATACATATGTACCTCTCCTAAGTTGTCAAAATCCGAAATCGAAACAAAAATAGGATCAGAAT
CAAGTGTAGATTTAGTAACAATTGCACAAGCAATGCATTGGTTTGATCTACCAACTTTTTATGAACATGTTAAATGGTTACTCAAGAAACCAAAT
GGTGTTATAGCATCATGGTGTTACACTACACCTAAAATAAACAACTCAGTAGATGCAATATTTGATAAATTTTACACAAGTGATGCTGGACCTTA
TTGGGAATCACCAAGAAAATTGGTCGATGAAAAGTATGAAACTATTGATTTTCCATTTGAGGCTATAGATGGATGTGATCATAATGGACCATTTG
AGTTCAAGATTGAGAAAGTTATGGACTTGGATTCTTGTTTTACATACTTGAAGTCATGGTCAGCTTATCAAACTGCAAAAGAAAAGGGTGTTGAG
TTGTTAAGTGAAGATGTTGTTGAAAAATTTACAAGTGCTTGGAATGAAGATGGGAAGAGTGAGAAAAAAGTGATTTATCCTATTTACTTGAGGAT
TGGAAAAGTTGGAAATTTGGATTGAAAGTGTAAAGCAAATACAATTAGTTATGTGCACTTGATCATCTATTTATTTTGTATGTTATTTCTCTTAG
TTGTTATTGTTATGTATCTTTTAATAATATAAAGTATCTAAGTACTAATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378668] SGN-U580752 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1317 [Download] [View] Facility Assigned ID: TUS19A18.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0031 Quality Trim Threshold: 12.5