EST details — SGN-E17483

Search information 
Request: 17483Match: SGN-E17483
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C114458Clone name: cTOA-23-M4
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C114458 [cTOA-23-M4] Trace: SGN-T127790 EST: SGN-E316051 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E17483Length: 309 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E17483 [] (called/trimmed by facility)
TCTCACTTGCCTTTCAGAGGATAACCGGAGCGGCGACCACCTTGCTTGACAAAATGGCGCAAGAATCACTTGTCCTTCGCGGCACCATGAAAGCC
CACACCGATTGGGTCACTGCCATCGCCACCCCAATTGATAACTCTGACATGATTGTTACTTCCTCCAGGGACAAGTCCATCATTGTCTGGTCTCT
CACCAAGGATGGCGCACAGTACGGTGTCCCCCGCCGCCGTCTCACAGGCCACGGCCACTTTGTTCAGGATGTTGTTCTCTCCTCCGACGGGATGT
TTGCTCTCTCTGGTTCTTGGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T127790 [Download] [View] Facility Assigned ID: TFADL74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence