EST details — SGN-C175095

Search information 
Request: 175095Match: SGN-C175095
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C175095Clone name: TUS-20-H5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175095 is on microarray TOM1 spot ID 1-1-4.4.14.20 [Order] [Tomato Microarray Database]
See unigene SGN-U585837 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C23946 [cLED-6-M17] Trace: SGN-T50123 EST: SGN-E233137 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377554Length: 683 bp (875 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E377554 [] (trimmed) CTGCACTCCACCGATCATTCATCGCGATGTAAAATCAAGCAATATCTTGTTGGATTCTGATTTCACAGCCAAAATAGCTGATTTTGGGTTAGCCA
AGATTTTAGAGAAGAAAGGAGAGCTTAACACCATGTCTGCTGTTGCGGGTTCCTTTGGTTACATAGCACCAGAGTATGCTTATACAACGAAAGTG
AATGAGAAGATTGATATCTATAGCTTTGGGGTGGTGCTATTGGAGCTAGTGACAGGAAGACAACCAAATTTTGGGGATGAGCATACAAGCCTGGC
AGAATGGGCATGGAAGCAACACGGAGAAGGGAACACTGCCATCGATAATATGTTAGATACGGATATCAAAGAAACATGCTACTTGGAAGAAATGA
AGACAGTGTTCAGACTCGGGCTTATATGCACGAGCAACTTACCTGCGAGCAGGCCTTCCATGAAAGAGATTCTGCAGATACTTCATCGATGCAAG
TCCTTTAGGTATTCTGGAGGAAAATCACCAGATACAGAGTATGATGTTGCTCCTCTCCTTAGCGGGAACAACAGCGAAAAATACATTGCTAGTTA
CAAACGTATTAATTCCAATAAGGTAATAGATGATAGTAGTGATGATGGTCTAATAATTTCCAGTGTGTAATATTACAGATGCCAAAGTAATCTGA
TCATAGAAATAGGTCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377554] SGN-U585837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190053 [Download][View] Facility Assigned ID: FA0AAD8CD03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5