EST details — SGN-C175348

Search information 
Request: 175348Match: SGN-C175348
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C175348Clone name: TUS-21-B18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175348 is on microarray TOM1 spot ID 1-1-7.2.13.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24342 [cLED-7-O19] Trace: SGN-T50495 EST: SGN-E231986 Direction: 5' Facility: TIGR
Clone: SGN-C175348 [TUS-21-B18] Trace: SGN-T190638 EST: SGN-E378024 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378674Length: 514 bp (1220 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378674 [] (trimmed) TTAGGTGGAAACCCTCTCTCTCTCAATTGTCAAACAATCAAATTCTGAGTTGTAAAGCTTCAGAAGTTATGGGAAAGGACTCCAAGTCTAAGGAT
TCTGGAAGCAAGGGAAAGGGTAAACAGGCTGCTGGTGGAAGTGAGGATAATGCTTCGAAAGGAAAAGGAAAAGGTGGGAAAGGAGATGGCCTTGG
AACCTGCACATATGTTAAAGCAAGGCATGTCTTATGTGAGAAGCAGTCAAAGATTAATGAAGCATACAAAATACTACAGGAAGGCTGGCTGAACA
ACGGAGATAAAGTTCCACCAGCTGAGTTTGCTAAGGTAGCTGCAACTTACTCGGAATGCCCCTCAGGAAAGAAAGGTGGGGACCTGGGATGGTTT
CCACGTGGCAAGATGGCAGGCCCATTTCAGGAAGTTGCCTTCAATACCCCTGGTGGAGCTACCAGTGCACCCTTTAAATCAACACATGGATACCA
TTTCATTTTATCTGAAGGGAGGAAGAACTGAAATCTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378674] SGN-U564374 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1366 [Download] [View] Facility Assigned ID: TUS21B18.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5