EST details — SGN-C175427

Search information 
Request: 175427Match: SGN-C175427
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C175427Clone name: TUS-21-F1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175427 is on microarray TOM1 spot ID 1-1-8.2.13.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15236 [cLED-11-F19] Trace: SGN-T51531 EST: SGN-E235521 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377823Length: 98 bp (924 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E377823 [] (trimmed - flagged) CACAAAATGGTCCTTCCCTTCTGCTCCTTCCAAGCCAGTCACTTGCAACTATGGTTCTGTCATGCCGTCATGGTTTGACATTCATGAAATACCAG
TGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T190585 [Download][View] Facility Assigned ID: FA0AAD9CC01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.928 Expected Error Rate: 0.0175 Quality Trim Threshold: 14.5