EST details — SGN-C175462

Search information 
Request: 175462Match: SGN-C175462
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C175462Clone name: TUS-21-G12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175462 is on microarray TOM1 spot ID 1-1-5.3.13.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15306 [cLED-11-I4] Trace: SGN-T51324 EST: SGN-E235314 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378513Length: 331 bp (1320 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378513 [] (trimmed) AATGCCCCTTGTCCAAATGGTGTGTTTCTTCTCACAATTCGGATCGTGGACCTAGAGGTACACCTGTGAAATTCATTCCTCATTCTGAAGGTATG
TCTGAAAATAAACTATTCAACATACAATTCGATATTCCTACGTTCAGATTGTGTGTTAAATATACAATTTGGAAAGTGGGAGATTACAATGAAAC
TCTATGCGGGATATTATTGAAAACTGGAGGAAGCATACGGGATAGAGATAGCAGCTATTTCAAGATTGTTCCATCAAAACTTGATTACAACTTAG
TCCTTTGTGATCCTAGTCCTATTATCTGTCCATTTTGCCGGAAGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378513] SGN-U578475 Tomato 200607 Build 2 224 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1369 [Download] [View] Facility Assigned ID: TUS21G12.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0083 Quality Trim Threshold: 20.5