EST details — SGN-C177377

Search information 
Request: 177377Match: SGN-C177377
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C177377Clone name: TUS-26-G7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177377 is on microarray TOM1 spot ID 1-1-2.3.7.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37319 [cLEG-41-L15] Trace: SGN-T72140 EST: SGN-E259108 Direction: 5' Facility: TIGR
Clone: SGN-C177377 [TUS-26-G7] Trace: SGN-T182277 EST: SGN-E368867 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368868Length: 387 bp (949 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E368868 [] (trimmed) ACGAGGAGTATAGGTCGGTTTATTTGGGTACGAAGCCGGATGCTAGTCGCAGGTTGTCGAGTAGACAAAGTGATCGGTATGCTCCGAAGGTCGGA
GATAGGTTGCCGGAATCTGTTGATTGGGTGAAGAAAGGTGTGCTTGTTGGTGTTAAGGATCAAGGACAATGTGGGAGTTGCTGGGCTTTCTCAGC
AGTTGCTGCCATTGAAGCAGTAAACAAAATAAAGACTGGAGACTCGATCTCTTTATCCGAGCAGGAGCTAGTAGATTGTGATACTTCTTCTAACA
ATGGTTGTGACGGTGGTCTCATGGACTATGCTTTTGAATTCGTTATCAAAAATGGAGGACTAGACACTGAGGAAGATTACCCATATACTGGCGAG
GATGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368868] SGN-U569507 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182278 [Download][View] Facility Assigned ID: FA0AAD14AD04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5