EST details — SGN-C177702

Search information 
Request: 177702Match: SGN-C177702
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C177702Clone name: TUS-27-D20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177702 is on microarray TOM1 spot ID 1-1-5.4.6.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C47632 [cLEI-16-N24] Trace: SGN-T83474 EST: SGN-E269250 Direction: 5' Facility: TIGR
Clone: SGN-C177702 [TUS-27-D20] Trace: SGN-T193012 EST: SGN-E391686 Direction: 3' Facility: INRA
Clone: SGN-C177702 [TUS-27-D20] Trace: SGN-T193013 EST: SGN-E391687 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378762Length: 846 bp (1120 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378762 [] (trimmed) CTAGGCTGCCGTCGACCACCGCACGCGACAGCAGTCCAACGGCCAACTCTCGTGGCTTTGCCCCTTCACTAAATCCATATTTCCGGCTAAGCGTC
GGCTCCGGCTTGATCCTTCTAACAATCTCTACTTTCCATATGAACCTGGAAAGCAGGCGAAGAGTGCCATAAAGATTAAGAACACAAGCAAATCT
TTTGTAGCATTCAAGTTTCAAACTACTGCACCAAAGAGCTGCTACATGCGACCTCCGGGAGGTATTCTTGTACCTGGGGAAAGTTTGATTGCCAC
TGTCTTCAAGTTTATTGAACAACCTGAGAACAATGAGAAGCCTATAGATCAAAAGACCAAAGTAAAGTTCAAGATCATAAGTTTGAAGGTGAAAG
AAGGAACTGATTATGTACCTGAGTTGTTTGATGAACAAAAGGATAAAGTCTGTATTGAGCGTACTCTAAAGGTGGTGTTCTTGGACCCTGAACGC
CCTTCTCCAGCACTGGATAAACTAAAACGTCAGCTGGCCCAAGCTGAGGCTGCAACAGAAGCTGAGAAGAAACCTCCTGTTGACACAGGTCCGAA
AGTTGTGGGAGAAGGCTTAATAGTAGATGAATGGAAAGAGCGGAGGGAGAGGTATCTTGCTCGCCAACAAGTTGAGGCAGTGGATTCAGTAAAGC
AGTAGAGAGTGTTTATGTAAGTGCGTCTTTTTCCAGAATAGCAATGTATAATCAGATATGCACTTCTTATTATTGCCTTTCTTTGGATTGATGGT
GTAGAAGGTTAATGCAATGCTTCATGTAAAGAAGACACTGAGTGGAGATTTAAGATTATATAAGATTAGAAAATATTATATTCAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378762] SGN-U581077 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1459 [Download] [View] Facility Assigned ID: TUS27D20.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0044 Quality Trim Threshold: 12.5