EST details — SGN-C178015
Search information |
Request: 178015 | Match: SGN-C178015 |
Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
Clone information |
SGN ID: SGN-C178015 | Clone name: TUS-28-A21 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C178015 is on microarray TOM1 spot ID 1-1-4.1.4.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C64418 [cLEM-6-B2] | Trace: SGN-T84491 | EST: SGN-E270735 | Direction: 5' | Facility: TIGR |
Sequence |
Sequence Id: SGN-E370276 | Length: 137 bp (874 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E370276 [] (trimmed)
GTGAAAATGTCTGACGAAGAGCACCAATTTGAATCAAAAGCAGATGCCGGAGCTTCCAAAACTTACCCTCAACAAGCTGGTACTATTCGGAAGAA
CGGTTACATTGTAATCAAAGCTCGTCCTTGCAAGGTTGTGGA
CGGTTACATTGTAATCAAAGCTCGTCCTTGCAAGGTTGTGGA
Unigenes |
Current Unigene builds | |||||
[SGN-E370276] | SGN-U578967 | Tomato 200607 | Build 2 | 17 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T183203 [Download][View] | Facility Assigned ID: FA0AAD16AA11RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.949 | Expected Error Rate: 0.0113 | Quality Trim Threshold: 14.5 |