Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C178911

Search information 
Request: 178911Match: SGN-C178911
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C178911Clone name: TUS-30-G5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178911 is on microarray TOM1 spot ID 1-1-4.3.3.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71409 [cLER-17-M18] Trace: SGN-T96016 EST: SGN-E283165 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371735Length: 597 bp (936 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E371735 [] (trimmed) CCACTTTAAGTACAAAGTTTTTCATAAATCTCCCCTTCTTACCAACCCAAATTAAAGTACCCCACTTCCACCTCCAACCACTTCTTTTTTTTTTC
CTACCTTCCAAGAAGAAAATTACCAAAAATAAAAATAAAAATAGTAAAAGGGTACAAAGCATTTGCCCAGACATGTTAATACTGGACAACTTTCT
TTGTTACACACAAATTGAAAACAACTACACATACCCCATTTGTTTGGAAGAAATTAAAAAGGAAACTTCCTCTAATTCTTCTTCCACTAAAGAGC
TTTATGAAAAGAAAAAAAAAAGGAAGATACATGGACATGATAGCCTCCATGTTATGTTTGTTTTCTAAAAGTTTACAAAAGAGAAGTACTAATAT
ATAAAAAAAAAGTTGGTTTCTTCTCCTTCTTCTTCTTCCTCGTCTTTTGTAATTTTTTTTAATGGAAACCGCCCATGGCGACTGCTGGTTTAGCA
TCAGCAGGTGGTGATGGCAACATTGTGAGTGCTAAAACACCGCTCGCGGCAGCTGCAACTGCTCCAACTACAAATCCAGGCAAGTTTCCTCCTCC
AAACAAATCATCCCAGGGCCCTCCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371735] SGN-U581233 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184349 [Download][View] Facility Assigned ID: FA0AAD18AD03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5