EST details — SGN-C179508

Search information 
Request: 179508Match: SGN-C179508
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C179508Clone name: TUS-31-P2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179508 is on microarray TOM1 spot ID 1-1-7.4.2.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82334 [cLET-1-K1] Trace: SGN-T102387 EST: SGN-E292113 Direction: 5' Facility: TIGR
Clone: SGN-C82334 [cLET-1-K1] Trace: SGN-T102388 EST: SGN-E292114 Direction: 3' Facility: TIGR
Clone: SGN-C179508 [TUS-31-P2] Trace: SGN-T185606 EST: SGN-E373468 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373469Length: 455 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373469 [] (trimmed) TTTCAACAGAAAATTATGCCTGGTTTATGGAAGGATCTTCCTGGTAAGATCCATCACAAAGTGTCTGAAAATTGGATCAGCGCTACCCTCTTGCT
TGGTCCACTCGTCGGAACCTACTCGTATGTGCAGAACTTCCTGGAAAAGGAGAAGTTAGAACACAGATACTAAAACTGTTTCTTCATCAGTCTGT
TGGATACATCTCTATTCCATTTTGCAGTTTTCAACAGGAAATAAGCTGCCATTGTTGCATTTTTTTTTTTGGAACTTGTTATTTTGAAGATAATT
TACTTGTATGGCGCCCTATAAATAACAACTAAATTCTCTGTTGGGGTCTTTTGATTGTCTTGTGCATCCTAAATCTTATTCAGAAATAGAGTTTT
GAAAATAATTTGTAATACATTTCATTGACTTGCTGTTGAAGTCCCATTGTGATTGCACAATGAACAATTTTTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373469] SGN-U567580 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185607 [Download][View] Facility Assigned ID: FA0AAD19DH01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5