EST details — SGN-C179721

Search information 
Request: 179721Match: SGN-C179721
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C179721Clone name: TUS-32-H23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179721 is on microarray TOM1 spot ID 1-1-2.4.1.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80295 [cLET-11-M8] Trace: SGN-T105151 EST: SGN-E292688 Direction: 5' Facility: TIGR
Clone: SGN-C179721 [TUS-32-H23] Trace: SGN-T186156 EST: SGN-E373003 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378184Length: 1231 bp (untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378184 [] (untrimmed)
NNCCCCTAATTGANTTTTTAGNCCNNGATATGTTGAGCTTAATTACCGCCGCGCAAAGAGGAAGTGGAATATAAACGCACCAAATGAGGGGCCTT
TAAAAACGCCCGTTTTCTCGGGGTTTTATAAAAACCGTATNTTGGGTCCCTCTTTGCCCCCCTGGTTAACTCCCTCACACACTCGAGAATTGTAT
CACCCAAAAGCCGAGTGTCAACACTAGGTAGTGATTGCAAATGAGATCTAGGCCCTCACCGCGAGCGGGTGTGAATGCACCACTCCCCTATGTAT
AAAGTAGGTCCCTTAAATCTAGCACGCTCCATATCTCTGATAATACATACATCAACCCTGTGTGAAATCGACTAAAAGGGCTTGGATCCACTAGT
TCTAGAGCGGCCGCCACCGCGTAGAGAGCTCCAATATCACAATATAGGGAGTCGGATTACAAAGGGGNCGGGCGAGACGAATGATGTCTAAGTTA
GCCCTGGACAGTGGAGACGACAAAGCCTTGGAGGGGCTAGCGACCCATTACCCAATAGGGGGGGATTAAAAAGGGGNGCGGGGGTGACTCTTATG
AAAGCAATATAATATCAAAAATAAGGGGGGGGGGGGGGGGGGGGTTCAAACTACCAAAAAGATGTTTATTGAAAAGAAAAAAGGCAACGAGAGGG
AGAAGCCTTACATGAATGCGAAGAAAGGGAAAAACCTGAGGGCCAAACGATGTCAGAAGGAAGAATTTTGAAAAAAAAACCGCTCCGTAAACAAT
AACCCTCCGGGTTAAATAAAACATAGGTGACCACCAATTTTTTGTTGAGGTTCCTCCCAAAGGGAAGAAAAACTTCCAAAAGTTGAATTTTTCCC
TTAAAGGCCAAATTTGTGTATCGGGAAGGAAAAAAAAGGTTTACTCGCCTCATTAAAAAAAAAAAAATCGGGGGGGCCGGACCCTTTCCCTAAGG
GGGAAAAAAAANNNNNGGGGGGGGTCTATTACGAGGGAAGGGTGAGTAACTCGAGATGTGGGTGGAAAAAAGCATGAAAGTGGGGAGAGGTAATT
TAAGGGAGTTGTGGGAAAGAGTAGCAAGAATTGCACTAGCGGCAGACAGTGTTGACCACCAAGGACGAGGAGAGCACCCCAGAATGAGCAAAAGG
TTCGTTACCAGAGACAGGTCATATAGGACGAGTGAAGGGTGGACGAGATAAGAGGGTGTGTAATTATGGGCGTAAGAGTGACACAGTAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T1548 [Download] [View] Facility Assigned ID: TUS32H23.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Problems: High expected error (low overall quality)
Sequence Entropy: 0.000 Expected Error Rate: 0.0154 Quality Trim Threshold: 14.5