EST details — SGN-C180845

Search information 
Request: 180845Match: SGN-C180845
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C180845Clone name: TUS-35-G19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180845 is on microarray TOM1 spot ID 1-1-6.3.17.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C35469 [cLEG-35-B24] Trace: SGN-T70383 EST: SGN-E255899 Direction: 5' Facility: TIGR
Clone: SGN-C180845 [TUS-35-G19] Trace: SGN-T187402 EST: SGN-E375634 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375635Length: 334 bp (1209 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375635 [] (trimmed) TTTTAAGCTACGATTTGCTAAACTTGGCAGCTACTTGAGTCTTTTATAATCAAAATGCAAGAAAAGGTCTTAGTACACAGCAGAATACAATGGCT
TCAGTTACATCGATTAACTAATCCCCTCACTTCAAAAAGAAGCGCTCCTCCTACACGGATAATGGTGCATGACTGAACGTACTGTCTTTTGAATG
TCCAACTCAATTACACATGATAACCCCCAGGGTATCTACTCCTGCTCCATATCTGTAGGACCATCAGGTGTCTGTTCAGGTACATTTTCCTCCAC
CTTGTTAGCTCTATCATCGCTATCTGTACCCATCTTGTCTTCTTTGGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375635] SGN-U574887 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187403 [Download][View] Facility Assigned ID: FA0AAD23AD10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5