EST details — SGN-E18122

Search information 
Request: 18122Match: SGN-E18122
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65869Clone name: cLEN-11-N5
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65869 [cLEN-11-N5] Trace: SGN-T89552 EST: SGN-E274525 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E18122Length: 233 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E18122 [] (called/trimmed by facility)
TGTGGAGAGTGTTGGAGAGGGAGTAACAGACCTTGCACCAGGAGACCATGTTCTTCCTGTCTTTACAGGGGAATGTAAAGATTGTGCTCACTGTA
AATCTGAAGAAAGCAATATGTGTAGCCTCTTAAGGATTAACACTGACAGGGGAGTGATGCTTAATGATGGAAAATCAAGATTTTCCATCAATGGA
AACCCCATTTACCATTTTGTTGGGACCTCTACTTTTAGTGAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T89552 [Download] [View] Facility Assigned ID: TRRBQ75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence