Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C181311

Search information 
Request: 181311Match: SGN-C181311
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C181311Clone name: TUS-36-K5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181311 is on microarray TOM1 spot ID 1-1-4.3.15.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23773 [cLED-6-F1] Trace: SGN-T49974 EST: SGN-E232988 Direction: 5' Facility: TIGR
Clone: SGN-C181311 [TUS-36-K5] Trace: SGN-T187658 EST: SGN-E375100 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375101Length: 543 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375101 [] (trimmed) ATGAATGAAAAATGTTGTCACATAAATTTTAATAATCATAAACAAATTAGTAAACAACTGCTATTGTTTAAGTATTTGACTCTTACCAAAACTAA
GAAATTGAATAATCTAACTAAAAGATTCCTTCTATAACTAAACAACTAGTTGTTTTAATTTTTACCCAATACAAATTAATACAAATGATAACATT
GATCTGAGCTATCAACATCTGAGTTGCTACCATCTTCATGACTTTCTTTCTTCACCACTTTCATTTCTTGAACTGTACTTGTATTGCTCTTTGGA
GTTTCCTCTTTTATCTTGTTATGATGTTCCTCTCTTTTTTTTCTCCAATCACTCTTCCTTTTCCATTGTCTCACTAACAAAATCCCCAAACTTAA
AAACACAGCCATCCCCCTATGATCACAACCTCACTTAGCACCCAATGATCCCCCCTTCCCTTGGGGCAATATTGACCATATTGCAGCTATATAAG
CTGATGTCATAAATAATGTAGAAATCCACATTACTTTGTGCGTTGCCACCATTAATTTCAGTGGTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375101] SGN-U564709 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187659 [Download][View] Facility Assigned ID: FA0AAD24AF03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5