Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C181559

Search information 
Request: 181559Match: SGN-C181559
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C181559Clone name: TUS-37-E13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181559 is on microarray TOM1 spot ID 1-1-4.1.12.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C21097 [cLED-31-K17] Trace: SGN-T56646 EST: SGN-E242727 Direction: 5' Facility: TIGR
Clone: SGN-C181559 [TUS-37-E13] Trace: SGN-T194293 EST: SGN-E392967 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392968Length: 53 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E392968 [] (trimmed - flagged) GCTGCAGGTTTTAACCTCGCTCTTACTTCTTTTCACACTTCATGGGTAATTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T194294 [Download][View] Facility Assigned ID: FA0AAD25AC07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.000 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5