EST details — SGN-C182909

Search information 
Request: 182909Match: SGN-C182909
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182909Clone name: TUS-40-M19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182909 is on microarray TOM1 spot ID 1-1-6.1.5.9 [Order] [Tomato Microarray Database]
See unigene SGN-U581507 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C122662 [cTOB-4-K2] Trace: SGN-T130520 EST: SGN-E315032 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390283Length: 651 bp (869 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E390283 [] (trimmed) CAGATGAAATTCAATATTGTATCACCCGTTGCACTGTCTTGTCTCTTTTTCTTGTTCCTAACAAGTACTTTAGCACAAAATGCCGGTTCCATTGT
AACGCGGGAATTGTTCGAACAAATGCTGAGTTTTAAGAACAATGACGCATGTCCTGCCAAAGGATTCTACACTTATGATGCATTCATAGCTGCAG
CCAATTCGTTTCCAGGTTTTGGTACTGCTGGTGATGATACTGCACGTAAGAAGGAAATTGCTGCCTTTTTCGGTCAAACATCTCACGAAACTAAT
GGTGGTAGTGCAGGAACATTCACTGGAGGATATTGCTTTGTTAAGCAAATAGAGCAGACACACAGATACTATGGCAGAGGACCTATCCAATTGAC
ACACCAATCTAACTACGAACGAGCTGGACAAGGTATTGGTGTTGGACAAGAGTTAATGAACAACCCTGATTTAGTTGCGACAGATCCTATAATAT
CATTCAAAACAGCAATATGGTTCTGGATGACAGAACAGGATAATAAACCATCATGCCACAACGTTATCATTGGACAATGGACGCCATCCCCTAAA
GATACAGCAGCTAATAGAGTTTCAGGGTACGGTGTCATTACCAACATCATTAACGGTCAATTTGAATGTGGGATGGGTCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390283] SGN-U581507 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191609 [Download][View] Facility Assigned ID: FA0AAD28AG10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5