EST details — SGN-E183487

Search information 
Request: 183487Match: SGN-E183487
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37490Clone name: cLEG-42-D3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177463 is on microarray TOM1: SGN-S1-1-4.2.6.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37490 [cLEG-42-D3] Trace: SGN-T72458 EST: SGN-E259697 Direction: 5' Facility: TIGR
Clone: SGN-C177463 [TUS-26-J21] Trace: SGN-T182504 EST: SGN-E369890 Direction: 3' Facility: INRA
Clone: SGN-C177463 [TUS-26-J21] Trace: SGN-T182505 EST: SGN-E369891 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E183487Length: 536 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E183487 [] (called/trimmed by facility)
GGGTTCTTGTAATGGGTTGATTTGTTTAACCCCTATGTCATTTAAACTTATGATATGGAACCCTGTTACTGGAAAACACAAGGAATTTGAAGATT
CATTTGTTCAATGTGCTGTAAATTGTTATATACGATATGGGTTTGGTTATGATTATGTTAATGATGATTATAAGGTGGTTAAGATCTTTAGTTTT
CCGCGAAATGAGGGGAGATATGAGAATAAGGTGAAGGTTTATAGCTTGAAGTATGATTCTTGGAAAATGGGTGAGGCGTTTGATAGTGGTTATGT
TAATGCACAATCCGGGATGTGTTTGAATGGATATCTTCATTGGGAGGTAAGCCATTGTCGCGACTCTGGTGATGGTGATGGTGGTGGTGGTTCTT
CNGAGATAATGACATTGGATTTGTCTACGGAGACGTATGGAATAATGGCATTGCCTAATTGTGGAAATGGGAACACTAGTTGGTCGTTGAGTGTT
TTAAATGGATGTTTAGTTGCTTGTTGCAACTATCATTCNGTTAGGACGGATATGTGGGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T72458 [Download] [View] Facility Assigned ID: TBFGK14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence