EST details — SGN-E183524

Search information 
Request: 183524Match: SGN-E183524
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37523Clone name: cLEG-42-F17
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177480 is on microarray TOM1: SGN-S1-1-3.3.6.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37523 [cLEG-42-F17] Trace: SGN-T72295 EST: SGN-E259534 Direction: 5' Facility: TIGR
Clone: SGN-C177480 [TUS-26-K14] Trace: SGN-T182441 EST: SGN-E368308 Direction: 3' Facility: INRA
Clone: SGN-C177480 [TUS-26-K14] Trace: SGN-T182442 EST: SGN-E368309 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E183524Length: 450 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E183524 [] (called/trimmed by facility)
TTTAAAGGTGAGAATCTACTTGAGATGGAACCCGAGGAAAGATCTCTTGCTGGTCTTTTCATGAGCTTCCAGTCCCCAGTTGCCATACCTGGAGT
AAGCAATATTGACTTTCTTAACATGGCGTATAATGCTCAAAGGAGGAAACTTGGACTGCCAGAACTGGGACCAATTGAGTTTTACGGGTACATTG
CCCCGAAGCTTGAACTTGTCAACATGAAGATAGACTTCTTGAACAGAAATGTAAATGAAGGATTCAGTGGTGGAGAAAGGAAACGCAATGAGATT
CTGCAACTAGCGGTTCTCGGGGCTGACTTGGCAATACTGGATGAGATTGATTCTGGTTTAGATGTTGACGCACTTCGAGACGTAGCAAAGGCAGT
AAATGGACTTCTATCGCCAAAGAATTCAGTGTTGATGATTACTCATTACTTACGATTATTAGAATTCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T72295 [Download] [View] Facility Assigned ID: TBFGK33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence