EST details — SGN-C183999

Search information 
Request: 183999Match: SGN-C183999
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C183999Clone name: TUS-43-K5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183999 is on microarray TOM1 spot ID 1-1-4.3.19.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14810 [cLEC-9-C21] Trace: SGN-T25014 EST: SGN-E200720 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378626Length: 1130 bp (untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378626 [] (untrimmed)
NGACTTTGTTCTTTACCGCGTATGTGAGTCGTATTAACAGCCGGAGAGGGGTTNGATAAGACGAAAGGATGGGGGTTTTTATAAAAGCGGCGTCT
GGGTGNTTAGAAAAAAAGCNNNTTTTTNTTTTTTANNNNNGGGGTTTTGGGTGTTTGTNNNGGGGGGGGTGGGTTTTTTTCCCCGGGGGGGGGNG
GTGGNTGGGGGTTTNTTGGNNTNTTNTGGGGGTGNNGGGGGGGGGGGGGGGGGGTNTAANGATGTNTNNNNNTTTNNTNTTGGNTTTTTTTGGGG
GGGTNNNNTTTGGGGGNGGGTGTTNTTTTNGNGGGGGGGGAGGTTNTTTGTGTTTGGGGGGGGGGGGTTCCTTGTGGGGGGGTGGGGGGTGTTTG
GGGGGGGGGGGGGGGNGTTGGGGGNGTTTTTTTTGTGTTGGGNGGGGCGATTGGGCNNCNGGGGTTTTTTGGGGGTNGCCGTGGGGAGGGTGGNN
TTGGGTTGGGGCGGGGATTTTTTGGAAAAAAATTCGAAAAGAATGTGAAAAGTTGGAAAATTTTAAAGTAAAAAAATTAAAAAATGGGGGGGGGG
GGGGGGGGGACTTAAATCCCAAAAATTTTGGGGGGGAAATTTAAAAGGGGGAAGGAGGGGGGGGTTTTGAAAAAAAAAAAGGAGGGGAAAAGGGA
GGGATAAAGAAAAATTGGGGGGAAAATAAATAGGGAAAAAATAAGTGTGGGGAGGGGAAAAAAAAGAGGGGAGGGAAGGGGAGAAGGGGGAAAAG
GGGGGTTGGAGAAAAGGGGGTTATAAAAAAAGGGAGAGAGGGTATGATTGGGGGGGGAGAAGGTGTGGGGGAGGTTGTGTAGAAAAAAAAAAAAA
AATAGGGGAGGTAGGATGAAAGAGAAGACGAAAGAATGGGAGGGCTTTTGAGGAAAGAAGAAAAAAGAGGGGGGAAAAGGAAGGGTTTTTTGTGT
TAGATGAGGGGAGGAGTAGAGGGAGGGAAAAGAAAGGGGGAGAAAAAAAGGGGGGGGGAGGAGAAAGAGAGAGATAATGGAGGGGTGATGGATAG
GGGATAGGGGAGGGGGAGGGGGGAAGATGCGTTTGTGTATAGTAGAAAAAAAAGGGTGTGTAAAAACAAAGGAGGGAGAGGTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T1804 [Download] [View] Facility Assigned ID: TUS43K5.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Problems: High expected error (low overall quality)
Sequence Entropy: 0.000 Expected Error Rate: 0.0091 Quality Trim Threshold: 20.5