EST details — SGN-E184208

Search information 
Request: 184208Match: SGN-E184208
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23214Clone name: cLED-4-M5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174555 is on microarray TOM1: SGN-S1-1-8.1.15.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23214 [cLED-4-M5] Trace: SGN-T49412 EST: SGN-E231643 Direction: 5' Facility: TIGR
Clone: SGN-C174555 [TUS-19-A17] Trace: SGN-T197404 EST: SGN-E396078 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E184208Length: 640 bp (called/trimmed by facility)
Status: Legacy Direction: 5'
>SGN-E184208 [] (called/trimmed by facility)
GCACCAGGGAAGACCTTAAGAATGAGTTTGAGCGCGCCAATGGGAGTCAAATTGAAACTGCTGCTAGACCATATGCTTTTATTAAATTTGATACA
TTCATACAGAAGACGAAGAAACTGTACCAGGATACTAGAACTCAACGCAACATTTCTAAGTTGAATGATGAGCTTTACGAAGTTCATCAAATAAT
GACTCGAAATGTTCAAGAAGTTCTTGGAGTTGGTGAAAAGTTGGACCAGGTCAGTCAAATGTCCAGCCGTTTGACATCTGAATCCCGGATATATG
CTGATAAAGCAAAAGACTTAAATCGTCAGGCTTTGATTCGAAAATGGGCTCCTGTTGCTATTGTGCTTGGAGTTGTCATTCTCTTCTTCTGGCTC
AGAACAAAGATCTGGTGATGCTTCCATACAGATGCAGCTCAGTGACGACAATACTGTCAAATGTTTTATTCATATTTGTCACCATCAGACTCTGC
ACAACCCAGAGAACCACCTCACATTACAGTTATCCAGCATGTGTTGTGCCATATCAGTTNTATAGTGTAAAAGAGGAAAGGAACCGCGATGAATT
ATGTCCCTTAACCTTGAGAAATTACATTAAATTTTGGCTCTCTTTTAATATATTGGCCTTGGTAGGTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T49412 [Download] [View] Facility Assigned ID: TOVAM75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence