EST details — SGN-C184264
Search information |
Request: 184264 | Match: SGN-C184264 |
Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
Clone information |
SGN ID: SGN-C184264 | Clone name: TUS-44-F6 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184264 is on microarray TOM1 spot ID 1-1-3.2.16.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C78128 [cLES-4-I15] | Trace: SGN-T97960 | EST: SGN-E282219 | Direction: 5' | Facility: TIGR |
Clone: SGN-C184264 [TUS-44-F6] | Trace: SGN-T198376 | EST: SGN-E397050 | Direction: 3' | Facility: INRA |
Sequence |
Sequence Id: SGN-E397051 | Length: 120 bp (875 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E397051 [] (trimmed)
GTCAAGTTCCATTAATTGCTTATTTACTCATCATCACATTCATTAGCGCTGTAGTTTTATTTTGTAATGCATCCTTCTTTAGGGGTTAGCAAAAG
GAAAATGGCTTTCTTTTCCCCTTTT
GAAAATGGCTTTCTTTTCCCCTTTT
Unigenes |
Current Unigene builds | |||||
[SGN-E397051] | SGN-U566445 | Tomato 200607 | Build 2 | 42 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T198377 [Download][View] | Facility Assigned ID: FA0AAD32DC03RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.788 | Expected Error Rate: 0.0007 | Quality Trim Threshold: 12.5 |