EST details — SGN-E184654

Search information 
Request: 184654Match: SGN-E184654
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93743Clone name: cLEX-15-J22
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93743 [cLEX-15-J22] Trace: SGN-T117990 EST: SGN-E305504 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E184654Length: 603 bp (called/trimmed by facility)
Status: Legacy Direction: 5'
>SGN-E184654 [] (called/trimmed by facility)
GTTCACTCAAAATTCAACTACTCAAAGCAATTTACAATCAGTTGCTCGAATCATGACAGGCACAGGAGACGAAAATCAACCCAAATTTAAAAAAT
CAGAGTCTCAAATACCTTCTGTTTCTTCATCATCTTCAGATCCACAAGCACCATAAATGGATCCCCAAAAATGGGGTACCCATATTATGGGTCCG
GCTGCAGTTCCAACTTGTCATCCAGACAATCAGAAAGCTGCTTCATGGAGAGCTGAGGATCAAAGAGAAGAGTTTCAGCCACAGCCTTATGTTGT
TTATTCCCCAATTGATAAGCCTAGCAATAACCCACTTGATTCCGTTGTTAATGTGTTCAATTCATGGAGTAACAGAGCTGAGAACATAGCTCGCA
ACATTTGGTATAATCTGAAAGCTGGACCGTCAGTTACAGAAGCGGCATGGGGAAAACTTAATTTGACAGCTAAGGCGTTGACAGAGGGTGGATTT
GAGCCTCTTTACAAGCAGATTTTTGGAGCAGATCCTAATGAACAGCTGAAAAAGACGCTTGCTTGTTATCTTTCTACTGCGACTGGGCCTGTTGC
TGGTACACTCTATCTGTCAACTACTAAAGTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T117990 [Download] [View] Facility Assigned ID: TRXCH59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence