Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E184767

Search information 
Request: 184767Match: SGN-E184767
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37570Clone name: cLEG-42-H2
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37570 [cLEG-42-H2] Trace: SGN-T72333 EST: SGN-E259572 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E184767Length: 623 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E184767 [] (called/trimmed by facility)
CATCTATAAATGTGTTGTTATCCATAAATAACAACGCATTGAATTACCCAATCAATAAACTGTAATATGTTCACATAATTTACTATACACCAAAC
ATCAAAGAGCTGATTAACATTTATGGGAATCCAACACAAATAACCCTGATTTTCATTCGAGTACCTCGCACAAAACAACTTGTGAATCAAGCATC
AACTGCATTCTTTGAATGGTCACTCAAGTTTGTCTTCTTCACTTCATGATCCTTCATAGCAGCCGTAATTGCACCGTCAAGCATCCTGCAATACG
GCAATCGAACAGATGGACGATGGAAAAATGGTTTCCTATCTTCTCCAACTATATTTACGATTTTCCCCGTCTTTCTATCGATTATCGTCTTCGCA
TTAGGATTATATGCGACAAGACTAATACAGGGAACACCACCCTTAAAATAATCTTCCATCCATTTCCTCATCTTATCACTGATTTCGATTTTGAT
TTGAGGTTTCATCATATCCTCACAAACCGGAGCTCCGACGACATCCTCACCAACATCCCGATGATCATTGTAATAATATAGCTGCCGCCACCGCC
AAAGGTTCACCGTGGATACACCGGAAACTCGATTTACGATTTGTTTCAACATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T72333 [Download] [View] Facility Assigned ID: TBFGL37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence