EST details — SGN-C184849
| Search information |
| Request: 184849 | Match: SGN-C184849 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C184849 | Clone name: TUS-45-N15 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184849 is on microarray TOM1 spot ID 1-1-2.2.14.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C88823 [cLET-9-L22] | Trace: SGN-T104682 | EST: SGN-E289867 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E398725 | Length: 120 bp (950 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E398725 [] (trimmed)
CTCGCATTCAGCTCACTTTTGAAGGGGAGGGGAAGGATATCAACCTGCCAAATCGTCTGTGATGAACTGCCCAAAACAGCAAAGAATTTTTTGGC
ACTATGCTCTACTCATTAGAAGAAT
ACTATGCTCTACTCATTAGAAGAAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E398725] | SGN-U602198 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T200051 [Download][View] | Facility Assigned ID: FA0AAD33CG08RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.917 | Expected Error Rate: 0.0283 | Quality Trim Threshold: 14.5 |
Working
