EST details — SGN-E184891

Search information 
Request: 184891Match: SGN-E184891
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C137476Clone name: cTOE-22-K24
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C137476 [cTOE-22-K24] Trace: SGN-T152442 EST: SGN-E341253 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E184891Length: 391 bp (called/trimmed by facility)
Status: Legacy Direction: 5'
>SGN-E184891 [] (called/trimmed by facility)
TTGGTTTTGTAGATGATGTGGAATTTATTTTAGGCAAGGTCGAAGATGCAAGCCTAGTTCAAACAGTTCTTTTCAGTGCCACTTTGCCAGTCTGG
GTGAAGCATATTGCTTCTAAGTTTCTGAAACCAGATAAGAAAACGGCTGACCTTGTTGGTAATGAGAAAATGAAGGCCAGTAAAAATGTGAGGCA
TATTATTATTCCATGCTCTAGTTCTGCAAGACCTCAGCTTATTCCTGATATCATTCGGTGCTACGGCAGTGGAGGACGTACAATTATTTTTACTG
AGACAAGGGCGCTGGCTTCAGAGCTAGCTGGCTTACTGCCTGGGGCAAGTGCTTTGCATGGGGAGATACAACAGAACCAGCGTGAGGCTACACTT
AAAGGATTCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T152442 [Download] [View] Facility Assigned ID: TAIDH72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence