EST details — SGN-C185037
| Search information |
| Request: 185037 | Match: SGN-C185037 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C185037 | Clone name: TUS-46-F11 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185037 is on microarray TOM1 spot ID 1-1-6.2.12.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C72230 [cLER-1-I6] | Trace: SGN-T92111 | EST: SGN-E280557 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C185037 [TUS-46-F11] | Trace: SGN-T199029 | EST: SGN-E397703 | Direction: 5' | Facility: INRA |
| Clone: SGN-C185037 [TUS-46-F11] | Trace: SGN-T199090 | EST: SGN-E397764 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E378470 | Length: 201 bp (1081 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E378470 [] (trimmed)
AANTAGATATGAATTCTGATAAGGAGTGTCTTGTTAATACAATACTTTCTTGTGACCAACTACAATCTTAATCCAGTATACTTCTGTAAAATCAT
TAAAGATCAACATAGAAAGGATGCTGCCTTCTCGACGTGGCAAGATTTACCTGAGCATTCCCAGAGATAAACTCAAAAGTTGCTTCATAAGCCCC
ACAAAGCTTAG
TAAAGATCAACATAGAAAGGATGCTGCCTTCTCGACGTGGCAAGATTTACCTGAGCATTCCCAGAGATAAACTCAAAAGTTGCTTCATAAGCCCC
ACAAAGCTTAG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E378470] | SGN-U579558 | Tomato 200607 | Build 2 | 147 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T1861 [Download] [View] | Facility Assigned ID: TUS46F11.ab1 |
| Submitter: Koni | Sequencing Facility: Giov. Lab |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.950 | Expected Error Rate: 0.0032 | Quality Trim Threshold: 20.5 |
Working
