EST details — SGN-C185398

Search information 
Request: 185398Match: SGN-C185398
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C185398Clone name: TUS-47-E12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185398 is on microarray TOM1 spot ID 1-1-5.1.9.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71403 [cLER-17-M11] Trace: SGN-T95798 EST: SGN-E282947 Direction: 5' Facility: TIGR
Clone: SGN-C185398 [TUS-47-E12] Trace: SGN-T192179 EST: SGN-E390853 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390611Length: 239 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E390611 [] (trimmed) CTCCACTAAACCTAAAGAAAAATGGGGTTGTTCAACATCTCATTGTTACTCACTTGTCTCATGGTATTAGCCATATTTCACTCTTGTGAGGCCCA
AAATTCACCCCAAGACTATCTTGCGGTTCATAACGATGCCCGTGCCCAAGTCGGAGTCGGGCCTATGTCTTGGGATGCCTACTTGGCATCCCTAC
CACAAACCTATACCAACTCGAAAGCTGGTAACTTAAACTCCAATCATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390611] SGN-U579545 Tomato 200607 Build 2 213 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191937 [Download][View] Facility Assigned ID: FA0AAD35BC06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5